View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6033_high_49 (Length: 206)
Name: NF6033_high_49
Description: NF6033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6033_high_49 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 20 - 190
Target Start/End: Complemental strand, 50356134 - 50355964
Alignment:
| Q |
20 |
ctcccaaggtaaacagcctctttcatccatcacaccattcatgtcctcccccattaccggccattacaccggcgaaggcagtgcttccaatggcagacta |
119 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
50356134 |
ctcccgaggtaaacagcctctttcatccatcacaccattcatgtcctcccccattaccggccattacaccggcgaaggcagtggttccaatggcagacta |
50356035 |
T |
|
| Q |
120 |
ggtctatctccattccttaccccctctgtctcccgtggtaaacagcctcttgcatcttactcatccttcat |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
50356034 |
ggtctatctccattccttaccccctctgtctcccgtggtaaacagcctcttacatcttactcatccttcat |
50355964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University