View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6033_low_23 (Length: 301)
Name: NF6033_low_23
Description: NF6033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6033_low_23 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 10 - 301
Target Start/End: Complemental strand, 44093669 - 44093373
Alignment:
| Q |
10 |
attattctagaatgaaaattatgtgttagattacatgggatgannnnnnnagcaccaagttggttgccattttatatgttgcttttatcctgggtgtatg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44093669 |
attattctagaatgaaaattatgtgttagattacatgggatgatttttttagcaccaagttggttgccattttatatgttgcttttatcctgggtgtatg |
44093570 |
T |
 |
| Q |
110 |
tatctcctgattctgaagtctttttacaaatttggtgtctgatcaacatttctcttctgcagttt-----gtaattatgccaatggacaatggtagatta |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44093569 |
tatctcctgattctgaagtctttttacaaatttggtgtctgatcaacatttctcttctgcagtttaatttgtaattatgccaatggacaatggtagatta |
44093470 |
T |
 |
| Q |
205 |
actactgcggacaaaaagagaccatgtattctgggtttggttgtaaacaatggttatccccaatgtggccatgtagacggacaaaacgagcagattt |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44093469 |
actactgcggacaaaaagagaccatgtattctgggtttggctgtaaacaatggttatccccaatgtggccatgtagacggacaaaacgagcagattt |
44093373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University