View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6033_low_28 (Length: 271)
Name: NF6033_low_28
Description: NF6033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6033_low_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 9 - 203
Target Start/End: Original strand, 32132865 - 32133059
Alignment:
| Q |
9 |
agcaaaggaatggtactctctgtctttgaagtatcttcttatcaccaagaaactgcatcttcaaaaaatgaatattcacaaaactaggaacagtatgtca |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | |
|
|
| T |
32132865 |
agcaaaggaatggtactctctgtctttgaagtatcttcttatcaccaagaaactgcatcttcaaaaaatgaatattcacaagactaggaacagtatgtga |
32132964 |
T |
 |
| Q |
109 |
gcatttattaatatgaaataattgtatgcaaaactgtaatctagtagtactatgatatgattccccttaattcctacgttaaggtcatagaataa |
203 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32132965 |
gcatttaataatatgaaataattgtatacaaaattgtaatctagtagtactatgatatggttccccttaattcctacgttaaggtcatagaataa |
32133059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University