View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6033_low_29 (Length: 269)
Name: NF6033_low_29
Description: NF6033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6033_low_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 17 - 248
Target Start/End: Complemental strand, 38278258 - 38278035
Alignment:
| Q |
17 |
agttaaggtggcggagatggtggtgagtttggttttgatgggtgggagtgatttgggtgtggaggtgggagttatgagtgttggtgaagccatgattgtg |
116 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38278258 |
agttaaggtggaggagatggtggtgagtttggttttgatgggtgggagtgatttgggtgtggaggtgggagttatgagtgttggtgaagccatgattgtg |
38278159 |
T |
|
| Q |
117 |
ttgagagagagtaggagagattttgtgttatggtgatatgagaggaagatgtattggttttttgccacatggccttatcgtcttatctttgattttggtt |
216 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38278158 |
ttgagagagag--------agtttgtgttatggtgatatgagaggaagatgtattggttttttgccacatggccttatcgtcttatctttgattttggtt |
38278067 |
T |
|
| Q |
217 |
tttggatgagaaagcaaccaatggtttctaag |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38278066 |
tttggatgagaaagcaaccaatggtttctaag |
38278035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University