View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6033_low_38 (Length: 247)
Name: NF6033_low_38
Description: NF6033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6033_low_38 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 70 - 234
Target Start/End: Complemental strand, 44154955 - 44154791
Alignment:
| Q |
70 |
tattctcacgaactcaaaatatttgtgagaagcaacaacatattcgtagttcaaattccaatggtgaatccgagtcttagggagcagaaacagattctca |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
44154955 |
tattctcacgaactcaaaatatttgtgagaagcaacaacatattcgtagttcaaattccaatggtgaatccgagtctgagggagccgaaacagattctca |
44154856 |
T |
|
| Q |
170 |
gtcgcagtggtatcatcattgttctctctgattgatttcgtttgcgtgcttaatttattaataat |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44154855 |
gtcgcagtggtatcatcattgttctctctgattgatttcgtttgcgtgcttaatttattaataat |
44154791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 178 - 234
Target Start/End: Complemental strand, 40899565 - 40899509
Alignment:
| Q |
178 |
ggtatcatcattgttctctctgattgatttcgtttgcgtgcttaatttattaataat |
234 |
Q |
| |
|
||||| |||||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
40899565 |
ggtattatcattgttctctctgattgttttcacttgcgtgcttaatttattaataat |
40899509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 184 - 226
Target Start/End: Original strand, 40894477 - 40894519
Alignment:
| Q |
184 |
atcattgttctctctgattgatttcgtttgcgtgcttaattta |
226 |
Q |
| |
|
||||||||||| |||| |||||||| ||||||||||||||||| |
|
|
| T |
40894477 |
atcattgttctttctggttgatttcatttgcgtgcttaattta |
40894519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University