View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6033_low_39 (Length: 245)
Name: NF6033_low_39
Description: NF6033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6033_low_39 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 7 - 245
Target Start/End: Complemental strand, 976267 - 976026
Alignment:
| Q |
7 |
aatattttacgcgacaaattcaaataaaacttaccattctctattttannnnnnngaataatcgaaatccctaatctctataaaacaaaaactacattta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
976267 |
aatattttacgcgacaaattcaaataaaacttaccattctctattttatttttttgaataatcgaaatccctattctctataaaacaaaaactacattta |
976168 |
T |
 |
| Q |
107 |
atcataaatatgtcacaaaaaatcatcaccttgttattattattacttttaatttaaaatgtctcatattactgacgtacatgatcagaaag-attgcgg |
205 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
976167 |
atcataaatatgtcacaaaaaatcgtcaccttgttattattattacttttaatttaaaatgtctcatattactgacgtatatgatcagaaagaattgcgg |
976068 |
T |
 |
| Q |
206 |
tcaacaatgtagtttgaaag--atcgaaaatcctactttatt |
245 |
Q |
| |
|
||||||||||||||| |||| ||||||| |||||||||||| |
|
|
| T |
976067 |
tcaacaatgtagtttaaaagacatcgaaagtcctactttatt |
976026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University