View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6033_low_47 (Length: 228)
Name: NF6033_low_47
Description: NF6033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6033_low_47 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 7 - 228
Target Start/End: Original strand, 20073303 - 20073524
Alignment:
| Q |
7 |
acattgttgtttgaaatataagaatagttgaaaattgaatgttggcaccattcctcattaaaaaccatgcatttaactttattttccctccaaatttcac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| | |
|
|
| T |
20073303 |
acattgttgtttgaaatataagaatagttgaaaattgaatgttggcaccattcctcattaaaaaccatgcctttaactttattttccctccaaatttccc |
20073402 |
T |
|
| Q |
107 |
ttctttagttaacattagaacacaaaacactcagtttcaggacaccagtggcatattgtgacgctggagtggcaactgctgacgaacaccttcccggcat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20073403 |
ttctttagttaacattagaacacaaaacactcagtttcaggacaccagtggcatattgtgatgctggagtggcaactgctgacgaacaccttcccggcat |
20073502 |
T |
|
| Q |
207 |
tcgaacttcgccagggaaatat |
228 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
20073503 |
tcgaacttcgccagggaaatat |
20073524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University