View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6034_low_4 (Length: 250)
Name: NF6034_low_4
Description: NF6034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6034_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 59 - 128
Target Start/End: Complemental strand, 52443361 - 52443292
Alignment:
| Q |
59 |
atatcatgatccacctctccccttttaactttaaccgacatcttaaaccttctttcagtagactctaaaa |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52443361 |
atatcatgatccacctctccccttttaacttcaaccgacatcttaaaccttctttcagtagactctaaaa |
52443292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 208 - 250
Target Start/End: Complemental strand, 52443211 - 52443169
Alignment:
| Q |
208 |
attatgtgaaataacacttgagagttttattgttatattaaaa |
250 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
52443211 |
attatgtgaaataatacttgagagctttattgttatattaaaa |
52443169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University