View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6034_low_4 (Length: 250)

Name: NF6034_low_4
Description: NF6034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6034_low_4
NF6034_low_4
[»] chr3 (2 HSPs)
chr3 (59-128)||(52443292-52443361)
chr3 (208-250)||(52443169-52443211)


Alignment Details
Target: chr3 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 59 - 128
Target Start/End: Complemental strand, 52443361 - 52443292
Alignment:
59 atatcatgatccacctctccccttttaactttaaccgacatcttaaaccttctttcagtagactctaaaa 128  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
52443361 atatcatgatccacctctccccttttaacttcaaccgacatcttaaaccttctttcagtagactctaaaa 52443292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 208 - 250
Target Start/End: Complemental strand, 52443211 - 52443169
Alignment:
208 attatgtgaaataacacttgagagttttattgttatattaaaa 250  Q
    |||||||||||||| ||||||||| ||||||||||||||||||    
52443211 attatgtgaaataatacttgagagctttattgttatattaaaa 52443169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University