View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6035_low_2 (Length: 372)
Name: NF6035_low_2
Description: NF6035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6035_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 338; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 17 - 358
Target Start/End: Original strand, 48315762 - 48316103
Alignment:
| Q |
17 |
tacaagaccgtccgaacaaacactcgtcggtatagtgttcttgtcatccaaccgcgaaatcacgagaaggaacccgtttgcagttgcttcttcatggagc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48315762 |
tacaagaccgtccgaacaaacactcgtcggtatagtgttcttgtcatccaaccgcgaaatcacgagaaggaacccgtttgcagttgcttcttcatggagc |
48315861 |
T |
 |
| Q |
117 |
tctcttaatccaccacgatccgctgacgtgtccttcatcactgaatagatgcacacaaagccctgcaacatgtatgtgtgttttgtaagtaacattttat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48315862 |
tctcttaatccaccacgatccgctgacgtgtccttcatcactgaatagatgcacacaaagccctgcaacatgtatgtgtgttttgtaagtaacattttat |
48315961 |
T |
 |
| Q |
217 |
aaaatttagttgtttagaaagttggtaaggattttaatcatgcacctcttctgttcgtttgatttccattccgaagcgtgcttcgttgggttgagggatc |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
48315962 |
aaaatttagttgtttagaaagttggtaaggattttaatcatgcacctcttctgttcgtttgatttccattccgaagcgtgcttcgtcgggttgagggatc |
48316061 |
T |
 |
| Q |
317 |
aattctattggaatttcttctagtccaggtagaaaccataat |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48316062 |
aattctattggaatttcttctagtccaggtagaaaccataat |
48316103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University