View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6036_low_4 (Length: 267)
Name: NF6036_low_4
Description: NF6036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6036_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 131
Target Start/End: Original strand, 29446410 - 29446543
Alignment:
| Q |
1 |
atgattgtttatattatataaaataaatgaatagattatattcaacaaatgcatagtgtagtgaagc----atatgctaccaaaataagtagctttttta |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| |||| ||||||||||||||| | ||||||||||| |
|
|
| T |
29446410 |
atgattgtttatattatataaaataaatgaatagattatactcaacaaatgcatagtatag-caagcatatatatgctaccaaaatgaatagctttttta |
29446508 |
T |
 |
| Q |
97 |
atttctcattctttctctttaaggaatatccttca |
131 |
Q |
| |
|
||||||||||| || |||||||||||||||||||| |
|
|
| T |
29446509 |
atttctcattcattttctttaaggaatatccttca |
29446543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 178 - 235
Target Start/End: Original strand, 29446540 - 29446597
Alignment:
| Q |
178 |
ttcaaatgttcacacaaattcagacttagtacttaagagatttttgggttacaaaccc |
235 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29446540 |
ttcaaatgtgcatacaaattcagacttagtacttaagagatttttgggttacaaaccc |
29446597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University