View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6039_high_11 (Length: 206)
Name: NF6039_high_11
Description: NF6039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6039_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 66 - 189
Target Start/End: Original strand, 5798905 - 5799028
Alignment:
| Q |
66 |
cttgggtaacgttgaagagagaaccgagggattgaatagcggcgccttcatagtcggagtcggtgatcaccatattgactacggtctccggctaccacct |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5798905 |
cttgggtaacgttgaagagagaaccgagggattgaatagcggcgccttcatagtcggagtcggtgatcaccatattgactacggtctctggctaccacct |
5799004 |
T |
|
| Q |
166 |
ctctcaaaccggagcgcgccgctt |
189 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
5799005 |
ctctcaaaccggagcgcgccgctt |
5799028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University