View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6039_high_7 (Length: 260)
Name: NF6039_high_7
Description: NF6039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6039_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 124 - 243
Target Start/End: Original strand, 41308148 - 41308267
Alignment:
| Q |
124 |
gtagcatcaattctataagattcttacccttatgttggtaatagattctaactttattttatagaatcttcttttnnnnnnnnncaccgtgctgtgttta |
223 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41308148 |
gtagtatcaattctataagattcttacccttatgttggcaatagattctaactttattttatagaatcttctttaaaaaaaaaacaccgtgctgtgttta |
41308247 |
T |
 |
| Q |
224 |
atattagtatttgccttttg |
243 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
41308248 |
atattagtatttgccttttg |
41308267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 61 - 123
Target Start/End: Original strand, 41305564 - 41305624
Alignment:
| Q |
61 |
ggaggaagcctgatagtcactatttgattgcatattaatatgttaattttcttttagcaagat |
123 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41305564 |
ggaggaagcct--tagtcactatttgattgcatattaatatgttaattttcttttaacaagat |
41305624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University