View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6040_low_12 (Length: 305)
Name: NF6040_low_12
Description: NF6040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6040_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 34 - 290
Target Start/End: Complemental strand, 34962678 - 34962422
Alignment:
| Q |
34 |
caacattagagagtacagtaacactacagagtttttaagtcagaacggattaaacggacctcacccggcggaatcatcggcagcagcgaggcaaggacgg |
133 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34962678 |
caacattagtgagtacagtaacactacagagtttttaagtcagaacggattaaacggacctcacccggcggaatcatcggcagcggcgaggcaaggacgg |
34962579 |
T |
|
| Q |
134 |
aggagtacaccacttttcttaagagcaggtgaacagagttcaggacgaagttgtcttccaaagacaaggttcccgccatcagagactgatccgatcgatt |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34962578 |
aggagtacaccacttttcttaagagcaggtgaacagagttcaggacgaagttgtcttccaaagacaaggttcccgccatcagagactgatccgatcgatt |
34962479 |
T |
|
| Q |
234 |
tcacggagaggatggaagcgccattggtgagatgttcacgatgaagtttgttgagac |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34962478 |
tcacggagaggatggaagcgccattggtgagatgttcacgatgaagtttgttgagac |
34962422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University