View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6040_low_16 (Length: 247)
Name: NF6040_low_16
Description: NF6040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6040_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 7 - 135
Target Start/End: Complemental strand, 37215713 - 37215585
Alignment:
| Q |
7 |
cttttgatttatccattttatgtaagttgcttgaacatttcctctctttaacatgcaggtatgtttcagctgatattccaagtgatcttcaagtccaaat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37215713 |
cttttgatttatccattttatgtaagttgcttgaacatttcctctctttaacatgcaggtatgtttcagctgatattccaagtgatcttcaagtccaaat |
37215614 |
T |
|
| Q |
107 |
tggagaagccagcttccacttgcacaagg |
135 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37215613 |
tggagaagccagcttccacttgcacaagg |
37215585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 59 - 135
Target Start/End: Original strand, 1883648 - 1883724
Alignment:
| Q |
59 |
atgcaggtatgtttcagctgatattccaagtgatcttcaagtccaaattggagaagccagcttccacttgcacaagg |
135 |
Q |
| |
|
||||||||||||| || ||||| ||||||||||| ||| || |||||||| ||||| | |||||||||||| |||| |
|
|
| T |
1883648 |
atgcaggtatgttgcaactgatgttccaagtgattttcttgttcaaattggtgaagctaacttccacttgcataagg |
1883724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University