View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6043_low_11 (Length: 241)
Name: NF6043_low_11
Description: NF6043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6043_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 123 - 224
Target Start/End: Original strand, 39927944 - 39928045
Alignment:
| Q |
123 |
gattaatttttattgtcaaattttgtttatatttttaaacggatgaaatcatttgttggtatctcatagaatcagcggtccaagtcatcctatttatgct |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39927944 |
gattaatttttattgtcaaattttgtttatattttaaaacggattaaatcatttgttggtatctcatagaatcagcggtccaagtcatcctatttatgct |
39928043 |
T |
|
| Q |
223 |
at |
224 |
Q |
| |
|
|| |
|
|
| T |
39928044 |
at |
39928045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 13 - 61
Target Start/End: Original strand, 39927831 - 39927879
Alignment:
| Q |
13 |
atactagtgcggcagatctagaagcaagtgtttaattcgtcggtccgtc |
61 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39927831 |
atactagtgcggaagatctagaagcaagtgtttaattcgtccgtccgtc |
39927879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University