View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6043_low_3 (Length: 355)
Name: NF6043_low_3
Description: NF6043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6043_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 18 - 334
Target Start/End: Complemental strand, 48354602 - 48354288
Alignment:
| Q |
18 |
tgatcgaatcccacgacataaccatacacccccaacccacacacacnnnnnnnnnnnnngcgtaaattttagtttgacatacattaatattaatatacaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48354602 |
tgatcgaatcccacgacataaccatacacccccaacccacacacaaaaaaaaaaaaaa--cgtaaattttagtttgacatacattaatattaatatacaa |
48354505 |
T |
 |
| Q |
118 |
agaaaaatatataccttcacttccaaactctcataacgttgttgcagctgatgttgttgcaaggttgatgtggtggatgccacagtcttcacgctggtga |
217 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48354504 |
agtaaaatatataccttcacttccaaactctcataacgttgttgtagctgatgttgttgcaaggttgatgtggtggatgccacagtcttcacgctggtga |
48354405 |
T |
 |
| Q |
218 |
agcctcggcagcatccaccagaaaacggactaagtggctcttgctttgccttagaattctttgatgactgccgagacaggctcttctgaatctgaggact |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48354404 |
agcctcggcagcatccaccagaaaacggactaagtggctcttgctttgccttagaattcttcgatgactgccgagacaggctcttctgaatctgaggact |
48354305 |
T |
 |
| Q |
318 |
gtttcttgtgttcatga |
334 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
48354304 |
gtttcttgtgttcatga |
48354288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University