View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6043_low_6 (Length: 324)
Name: NF6043_low_6
Description: NF6043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6043_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 230 - 302
Target Start/End: Complemental strand, 3264656 - 3264584
Alignment:
| Q |
230 |
tggtgaaggtgtcggttgtggcggagggatcggtgtgggattgggttgttaggtgggagtcgaggccgattat |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3264656 |
tggtgaaggtgtcggttgtggcggagggatcggtgtgggattgggttgttaggtgggagtcgaggccgattat |
3264584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 113 - 146
Target Start/End: Complemental strand, 3264773 - 3264740
Alignment:
| Q |
113 |
tgttgacggggaaggttccgatgaggtggattgt |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
3264773 |
tgttgacggggaaggttccgatgaggtggattgt |
3264740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 230 - 302
Target Start/End: Original strand, 35371696 - 35371768
Alignment:
| Q |
230 |
tggtgaaggtgtcggttgtggcggagggatcggtgtgggattgggttgttaggtgggagtcgaggccgattat |
302 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
35371696 |
tggtgaaggtgtcggttgtggctgttggatcggtgtgggattgggttgttaggtgggaatcgaggctgattat |
35371768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 230 - 302
Target Start/End: Complemental strand, 27838501 - 27838429
Alignment:
| Q |
230 |
tggtgaaggtgtcggttgtggcggagggatcggtgtgggattgggttgttaggtgggagtcgaggccgattat |
302 |
Q |
| |
|
||||||||||||| |||||||| | |||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
27838501 |
tggtgaaggtgtcagttgtggctgttggatcggtgtgggattgggttgttaggtgggaatcgaggctgattat |
27838429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University