View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6044_low_4 (Length: 237)
Name: NF6044_low_4
Description: NF6044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6044_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 16 - 219
Target Start/End: Complemental strand, 3359777 - 3359574
Alignment:
| Q |
16 |
aagaagaaacctgaatttgaggcatgtcttgctagagaaccacttaacagtcccagatcagttattccaagtacgtctatgaatatatcaaccaagaggc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3359777 |
aagaagaaacctgaatttgaggcatgtcttgctagagaaccacttaacagtcccacatcagttattccaagtacgtctatgaatgtatcaaccaagaggc |
3359678 |
T |
|
| Q |
116 |
agcgtaaaccggaaacatggactgctgatacagtcttaaacaagccgacgaacagtaaaattacttggagggcgatgcaaccgggccaggatgaaattga |
215 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3359677 |
agcgtaaaccggaaacatggactgcttatacagtcttaaacgagccgacgaacagtaaaattacttggagggcgatgcaaccgggccaggatgaaattga |
3359578 |
T |
|
| Q |
216 |
tggt |
219 |
Q |
| |
|
|||| |
|
|
| T |
3359577 |
tggt |
3359574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University