View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6045_low_5 (Length: 239)
Name: NF6045_low_5
Description: NF6045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6045_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 1 - 121
Target Start/End: Original strand, 4269192 - 4269315
Alignment:
| Q |
1 |
atacattgttatggaacatttttctctctttgcataatctttggtggcttcctctgtttactagaaatgaacaatgtgaatgtagaataagttttagcc- |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4269192 |
atacattgttatggaacatttttctctctttgcataatctttggtggcttcctctgtttactagaaatgaacaatgtgaatgtagaataagttttagcca |
4269291 |
T |
|
| Q |
100 |
--ataaaataataatgaacttcaa |
121 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
4269292 |
taataaaataataatgaacttcaa |
4269315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 4269375 - 4269415
Alignment:
| Q |
181 |
ctgtagttagtagctagtgaccataagctagatatgactag |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4269375 |
ctgtagttagtagctagtgaccataagctagatatgactag |
4269415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University