View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6046_high_38 (Length: 276)
Name: NF6046_high_38
Description: NF6046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6046_high_38 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 5 - 201
Target Start/End: Original strand, 38840903 - 38841099
Alignment:
| Q |
5 |
aatcaaacagatgtcggcggtgattctacattgtatgcatcaaaattgattcaccgattgagcatataccaaaatattatcaaatatacaaaaatttcaa |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
38840903 |
aatcaaacagatgtcggcggtgattctacattgtatgcatcaaaattgagtcaccgattgagtatataacaaaatattatcaaatatacaaaaacttcaa |
38841002 |
T |
 |
| Q |
105 |
ttcattacaccaaacatgaaaaaccatagcagaatcatatatcaacagactcaatatcagttcattacaccaaaaattataaaccctggcaaaatca |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38841003 |
ttcattacaccaaacatgaaaaaccatagcagaatcatatatcaacagactcaatatcagttcattacaccaaaaattataaaccctagcaaaatca |
38841099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 26 - 86
Target Start/End: Original strand, 9876281 - 9876342
Alignment:
| Q |
26 |
gattctacattgtatgcatcaaaattgattcaccg-attgagcatataccaaaatattatca |
86 |
Q |
| |
|
|||||||||||||||||| ||||| || |||| |||||||||||||||||||||||||| |
|
|
| T |
9876281 |
gattctacattgtatgcactaaaatggaggcaccttattgagcatataccaaaatattatca |
9876342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University