View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6046_high_45 (Length: 253)
Name: NF6046_high_45
Description: NF6046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6046_high_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 50 - 166
Target Start/End: Complemental strand, 36291371 - 36291255
Alignment:
| Q |
50 |
accactttgattttcaaaattctatatcaataatgatgaacaaaaatccacttttaaaacattaattttcatttatgattcaaacgttatactttcaatt |
149 |
Q |
| |
|
|||| ||||||||||||| ||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36291371 |
accagtttgattttcaaacttctatatcaacaataatgaacaaaaatccacttttaaaacattaattttcatttatgattcaaacgttatactttcaatt |
36291272 |
T |
 |
| Q |
150 |
ttatgctaatctcatat |
166 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
36291271 |
gtatgctaatctcatat |
36291255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 164 - 253
Target Start/End: Complemental strand, 36291221 - 36291132
Alignment:
| Q |
164 |
tatgtgtctgtctagtagaaacaaagagcaataataatttatgaaccatttcaattactactagtctaatttctaacttcagaatcatca |
253 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36291221 |
tatgcgtctgtctagtagaaacaaagagtaataataatttatgaaccatttctattactactagtttaatttctaacttcagaatcatca |
36291132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University