View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6046_high_56 (Length: 204)
Name: NF6046_high_56
Description: NF6046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6046_high_56 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 68; Significance: 1e-30; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 120 - 187
Target Start/End: Original strand, 12513616 - 12513683
Alignment:
| Q |
120 |
gattaatcatgaataagacggtagagattgataacatgtcaaagaccaactctcccgaaagcgtaagt |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12513616 |
gattaatcatgaataagacggtagagattgataacatgtcaaagaccaactctcccgaaagcgtaagt |
12513683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 22 - 187
Target Start/End: Original strand, 12484830 - 12484988
Alignment:
| Q |
22 |
tttattatctaacaaatcctc-tcacacaaacactttgggcttgaagcatggaggataagcaaaccaactcaaacttgtgcacttgtgtttcaaactcag |
120 |
Q |
| |
|
||||||| |||||||| || | ||||||||||| |||||||| ||||||||||||||| ||||||| ||||||||| ||| ||||||||||| |
|
|
| T |
12484830 |
tttattacctaacaaacccccctcacacaaacattttgggctagaagcatggaggatatgcaaacccactcaaactggtg--------tttcaaactcaa |
12484921 |
T |
 |
| Q |
121 |
attaatcatgaataagacggtagagattgataacatgtcaaagaccaactctcccgaaagcgtaagt |
187 |
Q |
| |
|
||| || ||| ||| |||| ||||||||||| ||||||||||||||||||||| |||||| ||||| |
|
|
| T |
12484922 |
atttattatgcataccacggcagagattgataccatgtcaaagaccaactctccagaaagcttaagt |
12484988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University