View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6046_low_14 (Length: 462)
Name: NF6046_low_14
Description: NF6046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6046_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 358; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 358; E-Value: 0
Query Start/End: Original strand, 33 - 443
Target Start/End: Complemental strand, 15936133 - 15935723
Alignment:
| Q |
33 |
ttaattattgaaaatatttgattggctgcttttaagggtgaggtgttaggttcggcttcacgtaattagggnnnnnnngtttgttatatccaaaacagta |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15936133 |
ttaattattgaaaatatttgattggctgcttttaagggtgaggtgttaggttcggcttcacgtaattagggtttttttgtttgttatatccaaaacagta |
15936034 |
T |
 |
| Q |
133 |
gggttaaatactcatactcaaatatcacgtaacctaacctaacctgcctgctaaacaaacacaaacagatacaggatggcttccggctccggcaacgtcg |
232 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15936033 |
gggttaaatactcatactaaaatatcacgtaacttaacctaacctgcctgctaaacaaacacaaacagatacaggatggcttccggctccggcaacgtcg |
15935934 |
T |
 |
| Q |
233 |
tggacgaaaagttcgacccactcattcggcaagtggccatcagattggcaaacaaggtcccttacctccccaaatttgtgatatctcgtctccccgacga |
332 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
15935933 |
tggacgaaaagttcgacccgctcattcggcaagtggccatcagattggcaaacaaggtctcttacctccccaaatttgtaatatctcgtctctccgacga |
15935834 |
T |
 |
| Q |
333 |
tgaattatacgagctcctcggcaaaaagctttctaacctcaacgaaggcgaagcagatcgcatcctcgaagcggagttacaaaccatgttcgctcctttg |
432 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15935833 |
tgaattatacgagctcctcggcaaaaagctttctaacctccccgaaggcgaagcagatcgcatcctcgaagcggagttacaaaccatgttcgctcctttg |
15935734 |
T |
 |
| Q |
433 |
ggagccgttct |
443 |
Q |
| |
|
||||||||||| |
|
|
| T |
15935733 |
ggagccgttct |
15935723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University