View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6046_low_46 (Length: 253)

Name: NF6046_low_46
Description: NF6046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6046_low_46
NF6046_low_46
[»] chr2 (2 HSPs)
chr2 (50-166)||(36291255-36291371)
chr2 (164-253)||(36291132-36291221)


Alignment Details
Target: chr2 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 50 - 166
Target Start/End: Complemental strand, 36291371 - 36291255
Alignment:
50 accactttgattttcaaaattctatatcaataatgatgaacaaaaatccacttttaaaacattaattttcatttatgattcaaacgttatactttcaatt 149  Q
    |||| ||||||||||||| ||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36291371 accagtttgattttcaaacttctatatcaacaataatgaacaaaaatccacttttaaaacattaattttcatttatgattcaaacgttatactttcaatt 36291272  T
150 ttatgctaatctcatat 166  Q
     ||||||||||||||||    
36291271 gtatgctaatctcatat 36291255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 164 - 253
Target Start/End: Complemental strand, 36291221 - 36291132
Alignment:
164 tatgtgtctgtctagtagaaacaaagagcaataataatttatgaaccatttcaattactactagtctaatttctaacttcagaatcatca 253  Q
    |||| ||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||    
36291221 tatgcgtctgtctagtagaaacaaagagtaataataatttatgaaccatttctattactactagtttaatttctaacttcagaatcatca 36291132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University