View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6046_low_48 (Length: 248)
Name: NF6046_low_48
Description: NF6046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6046_low_48 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 13 - 230
Target Start/End: Complemental strand, 50327195 - 50326976
Alignment:
| Q |
13 |
tgaacaaaat-ctccgttgttttgaaacgagag--tatcatctttgatgacatatctagtacttgcatacattgaagtgttcatttagctttgcagtctt |
109 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
50327195 |
tgaacaaaatgctccgttgttttgaaacgagagagtatcatctttgatgacatatctagtacttgcatacaatcaagtgttcatttagctttgcagtctt |
50327096 |
T |
 |
| Q |
110 |
ttcttttccttgggctttttatactcgttaaaaaatactcgctgtgaaaacttagtaaatatcatgataattcaaacagaataaaaactatggaataaac |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
50327095 |
ttcttttccttgggctttttatact-gttaaaaaatactcgctgtgaaaactttgtaaatatcatgataattcaaacagaataaaaactattgtataaac |
50326997 |
T |
 |
| Q |
210 |
acatctaacccacgactaatt |
230 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
50326996 |
acatctaacccacgactaatt |
50326976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University