View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6046_low_51 (Length: 236)
Name: NF6046_low_51
Description: NF6046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6046_low_51 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 4e-93; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 44563937 - 44564153
Alignment:
| Q |
1 |
tctcatcattgtcactgtcactgcacaaatttgcggtagatttctatatttgtttcctcagatttctctatatacctgatcatgctactcacaaccttca |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44563937 |
tctcatcattgtcacagtcactgcacaaatttgcggtagatttctatatttgtttcctcagatttctctatataccttatcatgctactcacaaccttca |
44564036 |
T |
|
| Q |
101 |
ttccttcacagctcactaccttcattctctcnnnnnnnccttcattacacaaatggcttcttcttcttcatgggctcagaaaactggtttcaagccagta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44564037 |
ttccttcacagctcactaccttcattctctcaaaaaaaccttcattacacaaatgg---cttcttcttcatgggcccagaaaactggtttcaagccagta |
44564133 |
T |
|
| Q |
201 |
ttctccgccgagaccaaagc |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
44564134 |
ttctccgccgagaccaaagc |
44564153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 163 - 217
Target Start/End: Complemental strand, 36036773 - 36036719
Alignment:
| Q |
163 |
cttcttcatgggctcagaaaactggtttcaagccagtattctccgccgagaccaa |
217 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| |||| |||||||| ||||||||| |
|
|
| T |
36036773 |
cttcttcatgggctaagaaaaccggtttcaggccaaaattctccggcgagaccaa |
36036719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University