View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6046_low_53 (Length: 232)
Name: NF6046_low_53
Description: NF6046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6046_low_53 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 130 - 216
Target Start/End: Complemental strand, 27389077 - 27388991
Alignment:
| Q |
130 |
gtgtgtatattaggtttgttcggttgcagttttgatacgaaaaaagaggattatctaattccaggaattccattcagatatcgttat |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27389077 |
gtgtgtatattaggtttgttcggttgcagttttgatacgaaaaaagaggattatctaattccaggaattccattcagatatcgttat |
27388991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 13 - 59
Target Start/End: Complemental strand, 27389195 - 27389149
Alignment:
| Q |
13 |
attattctcatctcatcaatcgttgttgctttcacgaagtatgttac |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27389195 |
attattctcatctcatcaatcgttgttgctttcacgaagtatgttac |
27389149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University