View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6047_high_2 (Length: 387)
Name: NF6047_high_2
Description: NF6047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6047_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 348; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 348; E-Value: 0
Query Start/End: Original strand, 18 - 377
Target Start/End: Original strand, 52376385 - 52376743
Alignment:
| Q |
18 |
agtacccatatgaagcagttctgcagaacgagtttagtgatgcagctaaatgttttgtgaggggggtgcagatttttgataactcacctcttgcttcagt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52376385 |
agtacccatatgaagcagttctgcagaacgagtttagtgatgcagctaaatgttttgtgaggggggtgcagatttttgataactcacctcttgcttcagt |
52376484 |
T |
|
| Q |
118 |
gtctgatgcattgaagttgaaattgttggacagtatgagtgatacattaggaatgaaaatcacagcgtctacttgtttgacaactggaactgatttgttg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
52376485 |
gtctgatgcattgaagttgaaattgttggacagtatgagtgatacattaggaatgaaaatcacagcgtctacttgtttgacaactggtactgatttgttg |
52376584 |
T |
|
| Q |
218 |
aagcaaaatgcggtgacggatttgagcaagtggaattgtttgtgggtaactgtggcttggggtttcttcttcaggattctattctatttgtctttgttgc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52376585 |
aagcaaaatgcggtgacggatttgagcaagtggaattgtttgtgggtaactgtggcttggggtttcttcttcaggattctattctatttgtctttgttgc |
52376684 |
T |
|
| Q |
318 |
tgggtagcaagaacaagaggagttgatcaaagatgaacaccatccatcatactgtctgtg |
377 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
52376685 |
tgggtagcaagaacaagaggagttgatc-aagatgaacaccatccatcatactgtctgtg |
52376743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University