View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6047_low_1 (Length: 452)
Name: NF6047_low_1
Description: NF6047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6047_low_1 |
 |  |
|
| [»] scaffold0155 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 108; Significance: 5e-54; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 108; E-Value: 5e-54
Query Start/End: Original strand, 11 - 122
Target Start/End: Complemental strand, 2662707 - 2662596
Alignment:
| Q |
11 |
tcgaagaatataaagagaacaaaaaattaacacctaaggtcttcatgatcttcatctttttatccatgtcaacaaacagtgtgatcaaaatgcaaacaaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2662707 |
tcgaagaatataaagagaacaaaaaattaacacctatggtcttcatgatcttcatctttttatccatgtcaacaaacagtgtgatcaaaatgcaaacaaa |
2662608 |
T |
 |
| Q |
111 |
cattatgacatc |
122 |
Q |
| |
|
|||||||||||| |
|
|
| T |
2662607 |
cattatgacatc |
2662596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 178 - 289
Target Start/End: Complemental strand, 2662540 - 2662428
Alignment:
| Q |
178 |
atccaacgatacactttatgaggaattgacagttggcacaccctctctcaagaaaatttatagaa-ttggactaaaaagttttcaaaataccgaaattat |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2662540 |
atccaacgatacactttatgaggaattgacagttggcacaccctatctcaagaaaatttatagaatttggactaaaaagttttcaaaataccgaaattac |
2662441 |
T |
 |
| Q |
277 |
atttatcaagtta |
289 |
Q |
| |
|
||||||||||||| |
|
|
| T |
2662440 |
atttatcaagtta |
2662428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 357 - 389
Target Start/End: Complemental strand, 2662371 - 2662339
Alignment:
| Q |
357 |
ggtataggatatttgtttaacattcattatttc |
389 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
2662371 |
ggtataggatatttgtttcacattcattatttc |
2662339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0155 (Bit Score: 104; Significance: 1e-51; HSPs: 3)
Name: scaffold0155
Description:
Target: scaffold0155; HSP #1
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 178 - 293
Target Start/End: Complemental strand, 37780 - 37666
Alignment:
| Q |
178 |
atccaacgatacactttatgaggaattgacagttggcacaccctctctcaagaaaatttatagaattggactaaaaagttttcaaaataccgaaattata |
277 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
37780 |
atccaacgatacactttatgag-aattgacagttggcacaccctctctcaagaaaatttatagaattggactaaaaagttttcaaaataccgaaattaca |
37682 |
T |
 |
| Q |
278 |
tttatcaagttactgt |
293 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
37681 |
tttatcaagttactgt |
37666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0155; HSP #2
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 11 - 122
Target Start/End: Complemental strand, 37947 - 37836
Alignment:
| Q |
11 |
tcgaagaatataaagagaacaaaaaattaacacctaaggtcttcatgatcttcatctttttatccatgtcaacaaacagtgtgatcaaaatgcaaacaaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37947 |
tcgaagaatataaagagaacaaaaaattaacacttatggtcttcatgatcttcatctttttatccatgtcaacaaatagtgtgatcaaaatgcaaacaaa |
37848 |
T |
 |
| Q |
111 |
cattatgacatc |
122 |
Q |
| |
|
|||||||||||| |
|
|
| T |
37847 |
cattatgacatc |
37836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0155; HSP #3
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 357 - 434
Target Start/End: Complemental strand, 37601 - 37524
Alignment:
| Q |
357 |
ggtataggatatttgtttaacattcattatttcnnnnnnnaaaaatctcaatgaacattaaagttggtgcccgatttt |
434 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37601 |
ggtataggatatttgtttcacattctttatttcttttttaaaaaatctcaatgaacattaaagttggtgcccgatttt |
37524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 59; Significance: 8e-25; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 175 - 293
Target Start/End: Original strand, 22361561 - 22361679
Alignment:
| Q |
175 |
tacatccaacgatacactttatgaggaattgacagttggcacaccctctctcaagaaaatttatagaattggactaaaaagttttcaaaataccgaaatt |
274 |
Q |
| |
|
|||||||| ||| ||||||||| |||| |||||||||| |||||||| | ||||||| | |||||||||||| |||||||||||| |||||| | |||| |
|
|
| T |
22361561 |
tacatccagcgacacactttataaggacttgacagttgacacaccctatgtcaagaacttatatagaattggagtaaaaagttttccaaatactggaatt |
22361660 |
T |
 |
| Q |
275 |
atatttatcaagttactgt |
293 |
Q |
| |
|
| ||||||||||||||||| |
|
|
| T |
22361661 |
acatttatcaagttactgt |
22361679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University