View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6051_low_11 (Length: 353)
Name: NF6051_low_11
Description: NF6051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6051_low_11 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 8 - 353
Target Start/End: Original strand, 32684166 - 32684511
Alignment:
| Q |
8 |
ccaagaaaatatagatccaaaatatgacaaaatttgcagaagttgatggatacgaagtttgggtgtccatcaagtgcataataaaaatacaacaacaata |
107 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32684166 |
ccaaaaaaatatagatccaaaatatgacaaagtttgcacaagttgatggatacgaagtttgggtgtccatcaagtgcataataaaaatacaacaacaata |
32684265 |
T |
 |
| Q |
108 |
tatgaattatgtccaaaataaaattattcaggaaggaaacaggcacgaataaaatgatatgcatgcatgaagaaatcatagattccaagggatttattct |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32684266 |
tatgaattatgtccaaaataaaattattcaggaaggaaacaggcacgaataaaatgatatgcatgcatgaagaaatcatagattccatgggatttattct |
32684365 |
T |
 |
| Q |
208 |
tctctccatccgttaaagcttctactttgcaaatagggcaaatattttttatcatcagccattttattatgcagtcaacgtgatatccatgcttgcatcg |
307 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
32684366 |
tctctccatccgttaaagcttctaatttgcaaatagggcaaatattttttatcatcagccattttattatgcagtcaacgtgatatccatgcttgcattg |
32684465 |
T |
 |
| Q |
308 |
aagaattccaatcttctcttgaatcttaaattcttcctattcaagc |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32684466 |
aagaattccaatcttctcttgaatcttaaattcttcctattcaagc |
32684511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University