View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6051_low_19 (Length: 251)
Name: NF6051_low_19
Description: NF6051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6051_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 11 - 250
Target Start/End: Original strand, 32288244 - 32288482
Alignment:
| Q |
11 |
cacagagatacgctgccgcagcattgttcggactatcccttcacgattcccaaattaaccaaacccgcattctacccttacctgcttccgatgactccat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32288244 |
cacagagatacgctgccgcagcattgttcggactatcccttcacgattcccaaattaaccaaacccgcattctacccttacctgcttccgatgactccat |
32288343 |
T |
 |
| Q |
111 |
ctccaacatcaatcgaattagtagcagcagctctagcagttccgattctgtttccgatgatccccatctttgggtccaccaccattccggtttgctccga |
210 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32288344 |
ctccaacatcaatcgaattagtagtagcagctctagcagttccgattctgtttccgatgatccccatctttgggtccaccaccattccggtttactccga |
32288443 |
T |
 |
| Q |
211 |
cccgttttcaagttcgtcattatataactcccactctttt |
250 |
Q |
| |
|
|||||||||||||||||| ||| |||||| |||||||||| |
|
|
| T |
32288444 |
cccgttttcaagttcgtcgttaaataact-ccactctttt |
32288482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University