View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6051_low_21 (Length: 248)
Name: NF6051_low_21
Description: NF6051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6051_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 5 - 234
Target Start/End: Original strand, 32684533 - 32684768
Alignment:
| Q |
5 |
aaatcaaataaagaagtgccctaaaaaatttatatctaaaatatcaagtacaaaattattgaaaatattgaatcaagt------tgttgctgaaagatca |
98 |
Q |
| |
|
|||| |||||||||| |||||||||||||||| || | |||||| |||||||||||||||||||| |||||||||| | ||||||| || ||||| |
|
|
| T |
32684533 |
aaattaaataaagaaatgccctaaaaaatttaaatttgaaatattaagtacaaaattattgaaaagattgaatcaaatggaacttgttgctaaacgatca |
32684632 |
T |
|
| Q |
99 |
tacctggcatatcatgcaagcatcgatttcttgactgtcataaggtgaatataattttgtcttgagttgagtttcaattgttttctctggtatactagtg |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
32684633 |
tacctggcatatcatgcaagcatcgatttcttgactgtcataaggtgaatataattttgtcttaagttgactttcaattgttttctctggtaaactagtg |
32684732 |
T |
|
| Q |
199 |
cttacatcgccaatcctctcacccaatgcaacaagt |
234 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32684733 |
cttacattgccaatcctctcacccaatgcaacaagt |
32684768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University