View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6051_low_24 (Length: 240)
Name: NF6051_low_24
Description: NF6051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6051_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 8 - 225
Target Start/End: Complemental strand, 27940193 - 27939976
Alignment:
| Q |
8 |
tccaatgatagggagaggaactctgctgccttcaaacctagcactgcagtgatagtaggtgttttaacaaccacatttttccttgtgttgctactccttc |
107 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27940193 |
tccaatgatagggagaggagctctgatgccttcaaacctagcactgcagtgatagtaggtgttttaacaaccacatttttccttgtgttgctactccttc |
27940094 |
T |
|
| Q |
108 |
tctacgccagacactgcaaccgtgcagatatgcccgttgctagcaacccgaatcccaatggagaatcaaatttgcataagaggaaaaactctggaatcga |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27940093 |
tctacgccagacactgcaaccgtgcagatatgcccgttgctagcaacccgaatcccaatggagaatcaaatttgcataagaggaaaaactctggaatcga |
27939994 |
T |
|
| Q |
208 |
acgcgcggttgttgaatc |
225 |
Q |
| |
|
|||||||||||| ||||| |
|
|
| T |
27939993 |
acgcgcggttgtggaatc |
27939976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University