View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6051_low_26 (Length: 239)
Name: NF6051_low_26
Description: NF6051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6051_low_26 |
 |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0024 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 151 - 224
Target Start/End: Complemental strand, 130895 - 130822
Alignment:
| Q |
151 |
attagctttatctcctaaatcatctaccttagtccttttaattgcatcaaaatatatcttgtaaatattcaaat |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
130895 |
attagctttatctcctaaatcatctaccttagtccttttaattgcatcaaaatccatcttgtaaatattcaaat |
130822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 131046 - 131014
Alignment:
| Q |
1 |
ctttgattgtatgcaattcaggaattgagtacg |
33 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
131046 |
ctttgatagtatgcaattcaggaattgagtacg |
131014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 151 - 203
Target Start/End: Complemental strand, 14510494 - 14510442
Alignment:
| Q |
151 |
attagctttatctcctaaatcatctaccttagtccttttaattgcatcaaaat |
203 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14510494 |
attagccttatctcctaaatcatttaccttagtccttttaattgcatcaaaat |
14510442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University