View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6051_low_27 (Length: 238)
Name: NF6051_low_27
Description: NF6051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6051_low_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 15766842 - 15767064
Alignment:
| Q |
1 |
attttgcataaatagtaaattatttgatatattattcagacccgtcaaaattaactatgatctataaaagtttagaagaccttaattttaataggtttca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
15766842 |
attttgcataaatagtaaattatttgatatattattcagacccgtcaaaattaacgatgatctataaaagtttataaaaccttaattttaataggtttca |
15766941 |
T |
|
| Q |
101 |
attataagagaaggccgtcaaaagaaagatataagagaagaacgtatcttgttgtatctcttnnnnnnnnnnnnnntatattttgttgtattgatttttg |
200 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15766942 |
attataagagaagaccgtcaaaagaaagatataagagaagaacgtatcttgttgtatctctcaaaaaaaataaaaatatattttgttgtattgatttttg |
15767041 |
T |
|
| Q |
201 |
tataaacatgtacgccatatatt |
223 |
Q |
| |
|
||||||||||||||| ||||||| |
|
|
| T |
15767042 |
tataaacatgtacgctatatatt |
15767064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University