View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6051_low_8 (Length: 371)
Name: NF6051_low_8
Description: NF6051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6051_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 12 - 352
Target Start/End: Complemental strand, 5273779 - 5273445
Alignment:
| Q |
12 |
tgagatgaatgaggaaagtgtatggaattgtaacagttctactttgtgtctgtcactgagggaattaaggaaacctggtttgagttttgaaaaggcattg |
111 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5273779 |
tgagatgaatgaggaaagtgtgtggaattgtaacagttctactttgtgtctgtcactgagggaattaaggaaacctggtttgagttttgaaaaggcattg |
5273680 |
T |
|
| Q |
112 |
tcttctggtgcaaaaagggttaagccaccactgctagaatcnnnnnnnnnnnnnnnnnnnntaactagttgtgagttgagttggtttattaactgagttg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5273679 |
tcttctggtgcaaaaagggttaagccaccactgctagaatc------tgatgatgatgatgtaactagttgtgagttgagttggtttattaactgagttg |
5273586 |
T |
|
| Q |
212 |
ttttgagaagacgaatgagaactgagaatcnnnnnnnnnnnnngaggatttggataatgtctatggatggtgattttgggagaatatttggggtgggggc |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5273585 |
ttttgagaagacgaatgagaactgagaatctttttgcttttttgaggatttggataatgtctatggatggtgattttgggagaatattaggggtgggggc |
5273486 |
T |
|
| Q |
312 |
cccactcggggttactggtacaagggggactgtgttgaaac |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5273485 |
cccactcggggttactggtacaagggggactgtgttgaaac |
5273445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 40 - 140
Target Start/End: Complemental strand, 36151243 - 36151143
Alignment:
| Q |
40 |
tgtaacagttctactttgtgtctgtcactgagggaattaaggaaacctggtttgagttttgaaaaggcattgtcttctggtgcaaaaagggttaagccac |
139 |
Q |
| |
|
||||| ||||| ||||| ||||| ||| ||||||| || ||||| |||| ||||||||| || || ||| |||||||||||||||| |||||| |||| |
|
|
| T |
36151243 |
tgtaagagttcgactttttgtctatcagtgagggagttgaggaaccctgctttgagtttggagaatgcagaatcttctggtgcaaaaatggttaacccac |
36151144 |
T |
|
| Q |
140 |
c |
140 |
Q |
| |
|
| |
|
|
| T |
36151143 |
c |
36151143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 134
Target Start/End: Complemental strand, 36154629 - 36154535
Alignment:
| Q |
40 |
tgtaacagttctactttgtgtctgtcactgagggaattaaggaaacctggtttgagttttgaaaaggcattgtcttctggtgcaaaaagggttaa |
134 |
Q |
| |
|
||||| ||||| ||||| ||||| ||| ||||||| || ||||| |||| ||||||||| || || ||| |||||||||||||||| |||||| |
|
|
| T |
36154629 |
tgtaagagttcgactttttgtctatcagtgagggagttgaggaaccctgctttgagtttggagaatgcagaatcttctggtgcaaaaatggttaa |
36154535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University