View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6052_high_8 (Length: 251)
Name: NF6052_high_8
Description: NF6052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6052_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 36934247 - 36934011
Alignment:
| Q |
1 |
tgccttgaatctgctgaaatcctcttgatagctgcaactgagttcgagtctttaaaatagcccttataaacaccgccaaaaccaccttggccaagcttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36934247 |
tgccttgaatctgctgaaatcctcttgatagctgcaactgagttcgagtctttaaaatagcccttataaacaccgccaaaaccaccttggcctagcttct |
36934148 |
T |
 |
| Q |
101 |
gtgtctcttcaaagttgtttgttgcattcaacaattcataataactaatcttctttggtccagcacccatttggaattcatcatccatatcctgatcaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36934147 |
gtgtctcttcaaagttgtttgttgcattcaacaattcataataactaatcttctttggtccagcacccatttggaattcatcatccatatcctgatcaga |
36934048 |
T |
 |
| Q |
201 |
agtggtttctgaagtaggttcatcttcttttcctttg |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36934047 |
agtggtttctgaagtaggttcatcttcttttcctttg |
36934011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 48 - 188
Target Start/End: Complemental strand, 47871323 - 47871183
Alignment:
| Q |
48 |
gtctttaaaatagcccttataaacaccgccaaaaccaccttggccaagcttctgtgtctcttcaaagttgtttgttgcattcaacaattcataataacta |
147 |
Q |
| |
|
|||||| |||||||| ||||||||||| |||||||||||||| || | ||| ||||| ||||||||||| || |||||| | | ||||| || ||| | | |
|
|
| T |
47871323 |
gtctttcaaatagcctttataaacaccaccaaaaccaccttgtcctatcttttgtgtttcttcaaagttattggttgcacttaccaatttattatagcaa |
47871224 |
T |
 |
| Q |
148 |
atcttctttggtccagcacccatttggaattcatcatccat |
188 |
Q |
| |
|
| ||| || ||||||| ||| ||||||||||||||||||| |
|
|
| T |
47871223 |
aactttttaggtccagttcccttttggaattcatcatccat |
47871183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 49 - 188
Target Start/End: Original strand, 47874223 - 47874362
Alignment:
| Q |
49 |
tctttaaaatagcccttataaacaccgccaaaaccaccttggccaagcttctgtgtctcttcaaagttgtttgttgcattcaacaattcataataactaa |
148 |
Q |
| |
|
||||| |||||||| ||||||||||| |||||||||||||| || | ||| | || ||| ||||||| ||||||||| ||| ||||| | ||| | || |
|
|
| T |
47874223 |
tctttcaaatagcctttataaacaccaccaaaaccaccttgccctatcttttctgcttctgcaaagttatttgttgcactcaccaatttgttatagcaaa |
47874322 |
T |
 |
| Q |
149 |
tcttctttggtccagcacccatttggaattcatcatccat |
188 |
Q |
| |
|
||| || ||||||| ||| ||||||||||||||||||| |
|
|
| T |
47874323 |
actttttaggtccagtgcccttttggaattcatcatccat |
47874362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University