View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6052_low_11 (Length: 238)
Name: NF6052_low_11
Description: NF6052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6052_low_11 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 139 - 238
Target Start/End: Complemental strand, 29269827 - 29269728
Alignment:
| Q |
139 |
gtgaatgatgaagatgggcttcttcaaacggatatggtttgggcttgggattagaagcctatttgatagaacaattgcttttctcacctatctaattgct |
238 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29269827 |
gtgaatgatgaagatgggcttcttcaaaaggatatggtttgggcttgtgattagaagcctatttgatagaacaattgcttttatcacctatctaattgct |
29269728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 18 - 109
Target Start/End: Complemental strand, 29269940 - 29269849
Alignment:
| Q |
18 |
caatttggtactgagaggcaaagcggtgcgaaaccagctttgtataaagttgctgagttttgttgaattagggttttaaatggcgaaaatgg |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29269940 |
caatttggtactgcgaggcaaagcggtgcgaaaccagctttgtatgaagttgctgagttttgttgaattagggttttaaatggcgaaaatgg |
29269849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University