View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6052_low_12 (Length: 236)
Name: NF6052_low_12
Description: NF6052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6052_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 54151124 - 54151334
Alignment:
| Q |
1 |
aattgataaaaaatacgttgattgaaagagaatgtaacattatactcatactctaatgaagaggcttcaaagtggatggcgagtctttccctcacagata |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54151124 |
aattgatccaaaatacgttgattgaaagagaatgtaacattatactc------taatgaagaggcttcaaagtggatggcgagtctttccctcacagata |
54151217 |
T |
|
| Q |
101 |
acactccaaaggtaaatttcagctagttttcaaacaaaaatgattgctgctatattttattgaactgattcattttggattgatattcactctgtgagta |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54151218 |
acactccaaaggtaaatttc-----------aaacaaaaatgattgctgctatattttattgaactgattcattttggattgatattcactctgtgagta |
54151306 |
T |
|
| Q |
201 |
atgaaatcttgaatcattgcttcttctc |
228 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
54151307 |
ttgaaatcttgaatcattgcttcttctc |
54151334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University