View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6052_low_9 (Length: 250)
Name: NF6052_low_9
Description: NF6052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6052_low_9 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 4776037 - 4776286
Alignment:
| Q |
1 |
tgtatttgaagatctcgtgagatggagtccattggagatggtggatttgagatagcgcaatactctatttaaggcttgcatatctgtcacagtaggagct |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
4776037 |
tgtatttgaagatcttgtgagatggagtccattggagatggtggatttgagatagcgcaatactctcttcaaggcttgcatatctgtcacagtaggagct |
4776136 |
T |
 |
| Q |
101 |
tgcatttgttgtgctagtttattcaccgggaatgctatgtccgggcgtgtgattgaaaggtaatgtaaggcaccaagtatactgcgaaattccttactat |
200 |
Q |
| |
|
|||||||||| ||||||||||||||| || ||||| ||||| ||||| |||||||||||||| |||||||||||||| |||||||||||||||||||| | |
|
|
| T |
4776137 |
tgcatttgttatgctagtttattcactggaaatgcaatgtctgggcgagtgattgaaaggtagtgtaaggcaccaagcatactgcgaaattccttactgt |
4776236 |
T |
 |
| Q |
201 |
cacagtatgtggagtcaggtttaggttgtgagcagaatgaggtggccatg |
250 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4776237 |
cacagtatgtggagtcgggtttaggttgtgagcagaatgaggtggccatg |
4776286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University