View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6052_low_9 (Length: 250)

Name: NF6052_low_9
Description: NF6052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6052_low_9
NF6052_low_9
[»] chr1 (1 HSPs)
chr1 (1-250)||(4776037-4776286)


Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 4776037 - 4776286
Alignment:
1 tgtatttgaagatctcgtgagatggagtccattggagatggtggatttgagatagcgcaatactctatttaaggcttgcatatctgtcacagtaggagct 100  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||    
4776037 tgtatttgaagatcttgtgagatggagtccattggagatggtggatttgagatagcgcaatactctcttcaaggcttgcatatctgtcacagtaggagct 4776136  T
101 tgcatttgttgtgctagtttattcaccgggaatgctatgtccgggcgtgtgattgaaaggtaatgtaaggcaccaagtatactgcgaaattccttactat 200  Q
    |||||||||| ||||||||||||||| || ||||| ||||| ||||| |||||||||||||| |||||||||||||| |||||||||||||||||||| |    
4776137 tgcatttgttatgctagtttattcactggaaatgcaatgtctgggcgagtgattgaaaggtagtgtaaggcaccaagcatactgcgaaattccttactgt 4776236  T
201 cacagtatgtggagtcaggtttaggttgtgagcagaatgaggtggccatg 250  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||    
4776237 cacagtatgtggagtcgggtttaggttgtgagcagaatgaggtggccatg 4776286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University