View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6053_high_15 (Length: 349)
Name: NF6053_high_15
Description: NF6053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6053_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 11 - 330
Target Start/End: Complemental strand, 55452282 - 55451943
Alignment:
| Q |
11 |
cacagacaagctagctaatggaaataaataaatttatctgcacaaacattgtttacatacctctcctacgtaccgttgcatttttggcacctgaaaatgg |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55452282 |
cacaaacaagctagctaatggaaataaataaatttatctgcacaaacattgtttacatacctctcctacgtaccgttgcatttttggcacctgaaaatgg |
55452183 |
T |
 |
| Q |
111 |
ctgctaccatctagggatggcaaaaacaccc--------------------ataaaatctaacacggttacaggctcataccttgataaagtaagggtaa |
190 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
55452182 |
ctgctaccagctagggatggcaaaaacaccctacccggcgggtatccactaataaaatctgacacggttacaggctcataccttgataaagtaagtgtaa |
55452083 |
T |
 |
| Q |
191 |
aatgacttaaatatccttaggttaagtataaaagttagcagttccgtcaaaacaccccagatatcaactatttaggttat----ttttctctttcagatc |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
55452082 |
aatgacttaaatatccttaggttaagtataaaatttagcagttccgtcaaaacaccccagatatcaactatttaggttatttaattttctctttcagatc |
55451983 |
T |
 |
| Q |
287 |
tcactgactgcttccccatccatcaacactgtaactctccggtc |
330 |
Q |
| |
|
|| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
55451982 |
tc----actgcttccccatccatccacactgtaactctccggtc |
55451943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 292
Target Start/End: Original strand, 55466284 - 55466317
Alignment:
| Q |
259 |
tatttaggttatttttctctttcagatctcactg |
292 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
55466284 |
tatttaggttatttttctctttcatatctcactg |
55466317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University