View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6053_high_19 (Length: 299)
Name: NF6053_high_19
Description: NF6053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6053_high_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 9e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 9e-70
Query Start/End: Original strand, 107 - 283
Target Start/End: Original strand, 9721226 - 9721411
Alignment:
| Q |
107 |
ggagtttggagtatcataatataaaaacgcgagagaaatttcaaaagagaaaatctgaaattttcctcttat---------aaattttgtgacgagcaaa |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9721226 |
ggagtttggagtatcataatataaaaacgcgagagaaatttcaaaagagaaaatatgaaattttcctcttattttgccattaaattttgtgacgagcaaa |
9721325 |
T |
 |
| Q |
198 |
ctagagatgaattgttttagctttctacttgtttttcttaaccttaattttggttaaggaaaacataattatattgattaaaattt |
283 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
9721326 |
ctagagatgaattgtttcagctttctacttgttttccttaaccttaattttcgttaaggaaaacataattatattgattagaattt |
9721411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University