View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6053_high_31 (Length: 239)
Name: NF6053_high_31
Description: NF6053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6053_high_31 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 1532749 - 1532970
Alignment:
| Q |
1 |
tttcctagatagaacaaaatcccaaggcaagccaacgattaaaatttcaacaagtaataagaatcattcactttgatttcaatagagtcttcttcccaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1532749 |
tttcctagatagaacaaaatcccaaggcaagccaacgattaaaatttcaacaagtaataagaatcattcactttgatttcaatagagtcttcttcccaaa |
1532848 |
T |
|
| Q |
101 |
tagagtaagttctgtcatatacaacaaatacacttgataaatcatgacagtgaaagattatgactactagagctcgataaattgagagttgatggaatgg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1532849 |
tagagtaagttctgtcatatacaacaaatgcacttgataaatcatgacagtgaaagattatgactactagagcttgataaattgagagttgatggaatgg |
1532948 |
T |
|
| Q |
201 |
ggagaaagaaaacaatgagata |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
1532949 |
ggagaaagaaaacaatgagata |
1532970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 1537330 - 1537389
Alignment:
| Q |
153 |
aaagattatgactactagagctcgataaattgagagttgatggaatggggagaaagaaaa |
212 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1537330 |
aaagattatgactactagagcttgataaattgagagttaatggaatggggagaaagaaaa |
1537389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 1537271 - 1537320
Alignment:
| Q |
1 |
tttcctagatagaacaaaatcccaaggcaagccaacgattaaaatttcaa |
50 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1537271 |
tttcctagatagaaccaaatcccaaggcaagccaacgattaaaatttcaa |
1537320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University