View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6053_low_14 (Length: 377)
Name: NF6053_low_14
Description: NF6053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6053_low_14 |
 | |
|
| [»] scaffold0072 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0072 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: scaffold0072
Description:
Target: scaffold0072; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 16 - 314
Target Start/End: Complemental strand, 41972 - 41674
Alignment:
| Q |
16 |
aaaatcgtgatagcaataccctgaatttgaccgtggaaccgcatggtgcctttacgagcagaaccgttcaaggcattcagtgacaagtggtgctcctccg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41972 |
aaaatcgtgatagcaataccctgaatttgactgtggaaccgcatggtgcctttacgagcagaaccgttcaaggcattcagtgacaagtggtgctcctccg |
41873 |
T |
|
| Q |
116 |
taacaataggtggtgtttcagggtcagttgatggtgtgatttgcggtggtggtgggtcaggttcttcttcttcttcagtttgaaataagaaataatgacg |
215 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| |||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
41872 |
taacaataggtggtgtttcagggtcagctgatggtgtgatttgttgtggtggtggttcaggttcttcttcttcttcagtttggaataagaaataatgacg |
41773 |
T |
|
| Q |
216 |
atttggacatttatgagatatagagaatcgttcatcacaataataacataatcctttttctcttctcagcatcatctcagatctagtgatgtttttaac |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
41772 |
atttggacatttatgagatatagagaatcgttcatcacaataatagcataatcctttttctcttctgagcatcatctcagctctagtgatgtttttaac |
41674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 220 - 281
Target Start/End: Complemental strand, 8596080 - 8596019
Alignment:
| Q |
220 |
ggacatttatgagatatagagaatcgttcatcacaataataacataatcctttttctcttct |
281 |
Q |
| |
|
|||||||||||||| | |||||| ||||||||| |||||||||| |||||||||||||| |
|
|
| T |
8596080 |
ggacatttatgagaaaatgagaatttctcatcacaaaaataacataaacctttttctcttct |
8596019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University