View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6053_low_25 (Length: 267)
Name: NF6053_low_25
Description: NF6053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6053_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 107; Significance: 1e-53; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 76 - 242
Target Start/End: Original strand, 886054 - 886214
Alignment:
| Q |
76 |
atgcatgcattgcagggattacacggtgtccttcaaatttggcaacaatgataccgtgcggtcctttaaccttgatattgacacgggtagtgatctgact |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| | ||||||||||||||||||||||||||||||||| || ||| |
|
|
| T |
886054 |
atgcatgcattgcagggattacacggtgtccttcaaatttggcaacaatc---ccgtacagtcctttaaccttgatattgacacgggtagtgaactcact |
886150 |
T |
 |
| Q |
176 |
tgggttcagtgtgattataaaaaatgcctaggttgcaccatggtaataattaatcatgtttgacata |
242 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
886151 |
tgggttcagtgtgattat---caatgccaaggttgcactatggtaataattaatcatgtttgacata |
886214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 76 - 246
Target Start/End: Complemental strand, 31936281 - 31936113
Alignment:
| Q |
76 |
atgcatgcattgcagggattacacggtgtccttcaaatttggcaacaatgataccgtgcggtcctttaaccttgatattgacacgggtagtgatctgact |
175 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||| ||||| | || |||| | | ||||||||||| |||||||||||||| |||| | ||| |
|
|
| T |
31936281 |
atgcatgcattgcagggattacacagtgtccctcaaaattggctggca--attccgtacagccctttaacctttttattgacacgggtactgatttcact |
31936184 |
T |
 |
| Q |
176 |
tgggttcagtgtgattataaaaaatgcctaggttgcaccatggtaataattaatcatgtttgacataatta |
246 |
Q |
| |
|
|||||||||||| |||| ||||||||| ||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31936183 |
tgggttcagtgtttttatgaaaaatgccaaggatgcaccatggtaatcattaatcatgtttgacataatta |
31936113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 76 - 246
Target Start/End: Original strand, 31660105 - 31660273
Alignment:
| Q |
76 |
atgcatgcattgcagggattacacggtgtccttcaaatttggcaacaatgataccgtgcggtcctttaaccttgatattgacacgggtagtgatctgact |
175 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||| ||||| | || |||| | | ||||||||||| |||||||||||||| |||| | ||| |
|
|
| T |
31660105 |
atgcatgcattgcagggattacacagtgtccctcaaaattggctggca--attccgtacagccctttaacctttttattgacacgggtactgatttcact |
31660202 |
T |
 |
| Q |
176 |
tgggttcagtgtgattataaaaaatgcctaggttgcaccatggtaataattaatcatgtttgacataatta |
246 |
Q |
| |
|
|||||||||||| |||| ||||||||| | | ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31660203 |
tgggttcagtgtttttatgaaaaatgccaaagatgcactatggtaataattaatcatgtttgacataatta |
31660273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 138 - 246
Target Start/End: Complemental strand, 31974546 - 31974438
Alignment:
| Q |
138 |
cctttaaccttgatattgacacgggtagtgatctgacttgggttcagtgtgattataaaaaatgcctaggttgcaccatggtaataattaatcatgtttg |
237 |
Q |
| |
|
||||||||||| |||||||||||||| |||||| ||||| ||||||||| |||| ||||||||| ||| || ||||||| |||||||||||||||||| |
|
|
| T |
31974546 |
cctttaacctttttattgacacgggtactgatctcacttgtgttcagtgtttttatgaaaaatgccaaggatgtaccatggcaataattaatcatgtttg |
31974447 |
T |
 |
| Q |
238 |
acataatta |
246 |
Q |
| |
|
||||||||| |
|
|
| T |
31974446 |
acataatta |
31974438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 33 - 67
Target Start/End: Original strand, 885995 - 886029
Alignment:
| Q |
33 |
tatatttcttcctcaacttttattccaaaacttat |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
885995 |
tatatttcttcctcaacttttattccaaaacttat |
886029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 76 - 246
Target Start/End: Original strand, 31899556 - 31899726
Alignment:
| Q |
76 |
atgcatgcattgcagggattacacggtgtccttcaaatttggcaacaatgataccgtgcggtcctttaaccttgatattgacacgggtagtgatctgact |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| || || | ||| |||||||||||||||||||||||||||||||| ||| |
|
|
| T |
31899556 |
atgcatgcattgcagggattacacggtgtccttcaaaattggcaacaatcat---gtacagtcttttaaccttgatattgacacgggtagtgatctcact |
31899652 |
T |
 |
| Q |
176 |
tgggttcagtgtgattataa---aaaatgcctaggttgcaccatggtaataattaatcatgtttgacataatta |
246 |
Q |
| |
|
|||||||||||||||||| | |||||| ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31899653 |
tgggttcagtgtgattatgatgaaaaatgtgaaggttgcactctggtaataattaatcatgtttgacataatta |
31899726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University