View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6053_low_25 (Length: 267)

Name: NF6053_low_25
Description: NF6053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6053_low_25
NF6053_low_25
[»] chr3 (5 HSPs)
chr3 (76-242)||(886054-886214)
chr3 (76-246)||(31936113-31936281)
chr3 (76-246)||(31660105-31660273)
chr3 (138-246)||(31974438-31974546)
chr3 (33-67)||(885995-886029)
[»] chr6 (1 HSPs)
chr6 (76-246)||(31899556-31899726)


Alignment Details
Target: chr3 (Bit Score: 107; Significance: 1e-53; HSPs: 5)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 76 - 242
Target Start/End: Original strand, 886054 - 886214
Alignment:
76 atgcatgcattgcagggattacacggtgtccttcaaatttggcaacaatgataccgtgcggtcctttaaccttgatattgacacgggtagtgatctgact 175  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    |||| | ||||||||||||||||||||||||||||||||| || |||    
886054 atgcatgcattgcagggattacacggtgtccttcaaatttggcaacaatc---ccgtacagtcctttaaccttgatattgacacgggtagtgaactcact 886150  T
176 tgggttcagtgtgattataaaaaatgcctaggttgcaccatggtaataattaatcatgtttgacata 242  Q
    ||||||||||||||||||    |||||| ||||||||| ||||||||||||||||||||||||||||    
886151 tgggttcagtgtgattat---caatgccaaggttgcactatggtaataattaatcatgtttgacata 886214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 76 - 246
Target Start/End: Complemental strand, 31936281 - 31936113
Alignment:
76 atgcatgcattgcagggattacacggtgtccttcaaatttggcaacaatgataccgtgcggtcctttaaccttgatattgacacgggtagtgatctgact 175  Q
    |||||||||||||||||||||||| |||||| ||||| |||||    |  || |||| | | |||||||||||  |||||||||||||| |||| | |||    
31936281 atgcatgcattgcagggattacacagtgtccctcaaaattggctggca--attccgtacagccctttaacctttttattgacacgggtactgatttcact 31936184  T
176 tgggttcagtgtgattataaaaaatgcctaggttgcaccatggtaataattaatcatgtttgacataatta 246  Q
    ||||||||||||  |||| ||||||||| ||| |||||||||||||| |||||||||||||||||||||||    
31936183 tgggttcagtgtttttatgaaaaatgccaaggatgcaccatggtaatcattaatcatgtttgacataatta 31936113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 76 - 246
Target Start/End: Original strand, 31660105 - 31660273
Alignment:
76 atgcatgcattgcagggattacacggtgtccttcaaatttggcaacaatgataccgtgcggtcctttaaccttgatattgacacgggtagtgatctgact 175  Q
    |||||||||||||||||||||||| |||||| ||||| |||||    |  || |||| | | |||||||||||  |||||||||||||| |||| | |||    
31660105 atgcatgcattgcagggattacacagtgtccctcaaaattggctggca--attccgtacagccctttaacctttttattgacacgggtactgatttcact 31660202  T
176 tgggttcagtgtgattataaaaaatgcctaggttgcaccatggtaataattaatcatgtttgacataatta 246  Q
    ||||||||||||  |||| ||||||||| | | ||||| ||||||||||||||||||||||||||||||||    
31660203 tgggttcagtgtttttatgaaaaatgccaaagatgcactatggtaataattaatcatgtttgacataatta 31660273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 138 - 246
Target Start/End: Complemental strand, 31974546 - 31974438
Alignment:
138 cctttaaccttgatattgacacgggtagtgatctgacttgggttcagtgtgattataaaaaatgcctaggttgcaccatggtaataattaatcatgtttg 237  Q
    |||||||||||  |||||||||||||| |||||| ||||| |||||||||  |||| ||||||||| ||| || ||||||| ||||||||||||||||||    
31974546 cctttaacctttttattgacacgggtactgatctcacttgtgttcagtgtttttatgaaaaatgccaaggatgtaccatggcaataattaatcatgtttg 31974447  T
238 acataatta 246  Q
    |||||||||    
31974446 acataatta 31974438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 33 - 67
Target Start/End: Original strand, 885995 - 886029
Alignment:
33 tatatttcttcctcaacttttattccaaaacttat 67  Q
    |||||||||||||||||||||||||||||||||||    
885995 tatatttcttcctcaacttttattccaaaacttat 886029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 76 - 246
Target Start/End: Original strand, 31899556 - 31899726
Alignment:
76 atgcatgcattgcagggattacacggtgtccttcaaatttggcaacaatgataccgtgcggtcctttaaccttgatattgacacgggtagtgatctgact 175  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||| ||   || | ||| |||||||||||||||||||||||||||||||| |||    
31899556 atgcatgcattgcagggattacacggtgtccttcaaaattggcaacaatcat---gtacagtcttttaaccttgatattgacacgggtagtgatctcact 31899652  T
176 tgggttcagtgtgattataa---aaaatgcctaggttgcaccatggtaataattaatcatgtttgacataatta 246  Q
    |||||||||||||||||| |   ||||||   |||||||||  |||||||||||||||||||||||||||||||    
31899653 tgggttcagtgtgattatgatgaaaaatgtgaaggttgcactctggtaataattaatcatgtttgacataatta 31899726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University