View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6053_low_29 (Length: 252)
Name: NF6053_low_29
Description: NF6053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6053_low_29 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 139 - 252
Target Start/End: Complemental strand, 46079391 - 46079278
Alignment:
| Q |
139 |
tttcataagagaaatcaactaaatgtgtatggtgcaaactaatactacaataataataccgaccatccatccatccataatttaaatattaattatttcc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46079391 |
tttcataagagaaatcaactaaatgtgtatggtgcaaactaatactgcaataataatacccaccatccatccatccataatttaaatattaattatttcc |
46079292 |
T |
 |
| Q |
239 |
ccactcttgtggcc |
252 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
46079291 |
ccactcttgtggcc |
46079278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 17 - 107
Target Start/End: Complemental strand, 46079475 - 46079385
Alignment:
| Q |
17 |
agaaactcagcttataaactctttataaattcattttttatctttaatattatgtgaggcttgtgttttgccctataatatacattccata |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
46079475 |
agaaactcagcttataaactctttataaattcattttttatctttaatattatgcgaggcttgtgttttgccctataatatacatttcata |
46079385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University