View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6054_high_10 (Length: 218)
Name: NF6054_high_10
Description: NF6054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6054_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 93 - 142
Target Start/End: Complemental strand, 31393775 - 31393726
Alignment:
| Q |
93 |
atatcaagtatgtttggttggtaacataagtgatgtaagagcctctaagc |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31393775 |
atatcaagtatgtttggttggtaacataagtgatgtaagagcctctaagc |
31393726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University