View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6054_low_8 (Length: 247)
Name: NF6054_low_8
Description: NF6054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6054_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 31393565 - 31393448
Alignment:
| Q |
1 |
atttttagaaaaccattataatgaaaataaataagtgagtttgttgcttctagaaaatgttaaacaaatagttgctgctgctactgctaaataaataagt |
100 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31393565 |
attttgagaaaacctttataatgaaaataaataagtgagtttgttgcttctagaaaatgttaaacaaatagttgctgttgctactgctaaataaataagt |
31393466 |
T |
 |
| Q |
101 |
cttataacctagtgacta |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
31393465 |
cttataacctagtgacta |
31393448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 56 - 100
Target Start/End: Complemental strand, 28313504 - 28313460
Alignment:
| Q |
56 |
aatgttaaacaaatagttgctgctgctactgctaaataaataagt |
100 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28313504 |
aatgttgaacaaatagttactgctgctactgctaaataaataagt |
28313460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University