View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6057_low_5 (Length: 218)
Name: NF6057_low_5
Description: NF6057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6057_low_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 46 - 200
Target Start/End: Complemental strand, 33781779 - 33781625
Alignment:
| Q |
46 |
aaggcgtgtttggattctggttttttctatgttgtaaaccatggaattagtgaggaattcatggatgaggtttttgaacaaagtaagagatttttcaccc |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33781779 |
aaggcgtgtttggattctggttttttctatgttgtaaaccatggaattagtgaggaattcatggatgaggtttttgaacaaagtaagcgatttttcaccc |
33781680 |
T |
 |
| Q |
146 |
ttcctttgaaggaaaagatgaagattttgaggaatgaaaaacatagaggatatac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33781679 |
ttcctttgaaggaaaagatgaagattttgaggaatgaaaaacatagaggatatac |
33781625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University