View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6058_low_2 (Length: 394)
Name: NF6058_low_2
Description: NF6058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6058_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 8 - 381
Target Start/End: Original strand, 55356165 - 55356531
Alignment:
| Q |
8 |
gacatcatcaaatcaggggagaatttcaggatttctacgactaccaaaatgcctgaacagggaatttgtgaacgctgtggttatatttctagtcaggtat |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
55356165 |
gacatcatcaaatcaggggagaatttcaggatttctacgaccaccaaaatgcctgaacagggattttgtgaacgctgtggttatatttctagtcaggtat |
55356264 |
T |
 |
| Q |
108 |
ttttctcattatccatccctaaaacttggtttcatattatattattttatacaatacaatgctgctttccatccaaattgaacatttcttgctttcatac |
207 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55356265 |
ttttctcatta-ccatccctaaaacttggtttcatattatattat-----acaatacaatgctgctttccatccaaattgaacatttcttgctttcatac |
55356358 |
T |
 |
| Q |
208 |
cactataaacaggcttatcttatgtcctttgtttttcaactcaaatattctggttcattttagaacaattctgcatcattcacctttannnnnnnngttc |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
55356359 |
cactataaacaggcttatcttatgtcctttgtttttcaactcaaatattctggttcattttagaacaattctgcatcattcaccttta-tttttttgttc |
55356457 |
T |
 |
| Q |
308 |
tctttctcctcaattggctgtattgtaattcgggtgttcttagtcttgaatctcttatgcgctcttttctccct |
381 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55356458 |
tctttctcctcaattggctgtattgtaattcgggtgttcttagtcttgaatctcttatgcgctcttttctccct |
55356531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University